Top » Catalog » SNPs » A385

$19.00

A385
[A385]

A385
hg38 Position: ChrY:7205117..7205117
Ancestral: C
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a2c1g2a1c (not listed)
Comments: Downstream or equivalent L1402
Forward Primer: A385_F TTTAATCATGAAGAGGATATTGAAATATAAC
Reverse Primer: A385_R GGGCTCAAACAATCCTTGTG
Reviews

Customers who bought this product also purchased
A682
A682
A712
A712
R1b-L1402/3 downstream
R1b-L1402/3 downstream
A422
A422
A459
A459
A421
A421
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies