Top » Catalog » SNPs » Y5005

$18.00

Y5005
[Y5005]

Y5005
hg38 Position: ChrY:14214910..14214910
Ancestral: A
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: N1c1a1a1b (not listed)
Comments: Below VL29 > L1022
Forward Primer: Y5005_F TTTTTGAAATAATGTAGCCAAAAGG
Reverse Primer: Y5005_R ACTGTTTTGTGGAGTAGGCACA
Reviews

Customers who bought this product also purchased
Y90879
Y90879
Y132182
Y132182
A20806
A20806
A17605
A17605
A17277
A17277
BY32571
BY32571
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies