Top » Catalog » SNPs » Y39054

$18.00

Y39054
[Y39054]

Y39054
hg38 Position: ChrY:7812651..7812651
Ancestral: C
Derived: A
Reference: YFull (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: Y39054_F GTTTAGGTGCTGGTGCACAC
Reverse Primer: Y39054_R TGAATCTCCTTTCCGTCCAG
Reviews

Customers who bought this product also purchased
R1a-M458 Panel
R1a-M458 Panel
YP418
YP418
Y139228
Y139228
YP728
YP728
BY82741
BY82741
YP1137
YP1137
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies