Top » Catalog » SNPs » Y39054

$18.00

Y39054
[Y39054]

Y39054
hg38 Position: ChrY:7812651..7812651
Ancestral: C
Derived: A
Reference: YFull (2014)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: Y39054_F GTTTAGGTGCTGGTGCACAC
Reverse Primer: Y39054_R TGAATCTCCTTTCCGTCCAG
Reviews

Customers who bought this product also purchased
YP418
YP418
Y139228
Y139228
YP728
YP728
BY82741
BY82741
YP1137
YP1137
Y70897
Y70897
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies