Top » Catalog » SNPs » Z35267

$17.50

Z35267
[Z35267]

Z35267
HG19 Position: ChrY:16585370..16585370
Ancestral: G
Derived: C
Reference: Ray Banks (2015)
ISOGG Haplogroup: N1c (not listed)
Comments: Below L1022 > Y5005 > Y5003
Forward Primer: Z35267_F CCTCTAAGCAGACAGACTGTCATC
Reverse Primer: Z35267_R CATGATGTTAGATTAAGGCCCAC
Reviews

Customers who bought this product also purchased
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies