Top » Catalog » SNPs » PF1610

$18.00

PF1610
[PF1610]

PF1610
hg38 Position: ChrY:11430566..11430566
Ancestral: A
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: I1a2b (not listed)
Comments: Below Z138
Forward Primer: PF1610_F GCCTAATGCACGCAGCA
Reverse Primer: PF1610_R GCAGGGAGCCTACTCTCTAAAG
Reviews

Customers who bought this product also purchased
M9
M9
*TOP* - Top-Level Orientation Panel
*TOP* - Top-Level Orientation Panel
M267
M267
HU170
HU170
FGC40709
FGC40709
FGC1695
FGC1695
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies