Top » Catalog » SNPs » PF1610

$18.00

PF1610
[PF1610]

PF1610
hg38 Position: ChrY:11430566..11430566
Ancestral: A
Derived: T
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: I1a2b (not listed)
Comments: Below Z138
Forward Primer: PF1610_F GCCTAATGCACGCAGCA
Reverse Primer: PF1610_R GCAGGGAGCCTACTCTCTAAAG
Reviews

Customers who bought this product also purchased
BY138887
BY138887
Y60236
Y60236
ZS7282
ZS7282
FT77163
FT77163
ZS5804
ZS5804
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies