Top » Catalog » SNPs » Z306

$18.00

Z306
[Z306]

Z306
hg38 Position: ChrY:20625892..20625892
Ancestral: C
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1c1a
Comments: downstream of U106 upstream of L1;downstream of Z156
Forward Primer: Z306_F ATGTTCCCTTGGTCTCTGTG
Reverse Primer: Z306_R CAGCAACCAAAGCAAAGATG
Reviews

Customers who bought this product also purchased
S1911
S1911
S5556
S5556
A9580
A9580
Y18100
Y18100
FGC39801
FGC39801
M9
M9
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies