Top » Catalog » SNPs » Z306

$18.00

Z306
[Z306]

Z306
hg38 Position: ChrY:20625892..20625892
Ancestral: C
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a1c1a
Comments: downstream of U106 upstream of L1;downstream of Z156
Forward Primer: Z306_F ATGTTCCCTTGGTCTCTGTG
Reverse Primer: Z306_R CAGCAACCAAAGCAAAGATG
Reviews

Customers who bought this product also purchased
FT363853
FT363853
FGC39800
FGC39800
FGC39815
FGC39815
Y302853
Y302853
Y29893
Y29893
BY118350
BY118350
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies