Top » Catalog » SNPs » Z1930

$18.00

Z1930
[Z1930]

Z1930
hg38 Position: ChrY:13217466..13217466
Ancestral: C
Derived: G
Reference: Ray Banks (2012)
ISOGG Haplogroup: N1c (not listed)
Comments: Downstream L1026 > Z1936
Forward Primer: Z1930_F TTATGGTTCAACAGGGAATTGAG
Reverse Primer: Z1930_R TGTCAACACACCCAACTAACTTTC
Reviews

Customers who bought this product also purchased
Z1936
Z1936
Y13850
Y13850
CTS6904
CTS6904
Z1934
Z1934
CTS9976
CTS9976
CTS4329
CTS4329
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies