Top » Catalog » SNPs » FGC8410

$18.00

FGC8410
[FGC8410]

FGC8410
hg38 Position: ChrY:26629848..26629848
Ancestral: G
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC8410_F GCCTAGATGACCAAGTGACACC
Reverse Primer: FGC8410_R TAACATGATGTTTTTAACGTCCATCTAC
Reviews

Customers who bought this product also purchased
FGC23212
FGC23212
BY128969
BY128969
A14207
A14207
A993
A993
FGC13326
FGC13326
FGC8383
FGC8383
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies