Top » Catalog » SNPs » S10185

$18.00

S10185
[S10185]

S10185
hg38 Position: ChrY:7498094..7498094
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream S16265
Forward Primer: S10185_F CAGTCAATGAGATGTTCCCGT
Reverse Primer: S10185_R CTCTCCCTCCTCCCTTCC
Reviews

Customers who bought this product also purchased
FGC12364
FGC12364
S16265
S16265
FGC12374
FGC12374
FGC12355
FGC12355
S17693
S17693
FGC12363
FGC12363
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies