Top » Catalog » SNPs » S10185

$18.00

S10185
[S10185]

S10185
hg38 Position: ChrY:7498094..7498094
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream S16265
Forward Primer: S10185_F CAGTCAATGAGATGTTCCCGT
Reverse Primer: S10185_R CTCTCCCTCCTCCCTTCC
Reviews

Customers who bought this product also purchased
FGC12366
FGC12366
FGC12352
FGC12352
A8617
A8617
A8613
A8613
A8619
A8619
FGC12365
FGC12365
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies