Top » Catalog » SNPs » FGC57150

$18.00

FGC57150
[FGC57150]

FGC57150
hg38 Position: ChrY:9992208..9992208
Ancestral: T
Derived: C
Reference: Full genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: Below FGC11 > Y5321 > Y20903
Forward Primer: FGC57150_F GTTATAAATTTCTGTGTGGTGCAATAC
Reverse Primer: FGC57150_R TGGGGATGGCAAGATACCA
Reviews

Customers who bought this product also purchased
FGC5
FGC5
ZS5010
ZS5010
FGC44917
FGC44917
J1-M267 Superclade Panel
J1-M267 Superclade Panel
FGC7393
FGC7393
Y20902
Y20902
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies