Top » Catalog » SNPs » FGC57150

$18.00

FGC57150
[FGC57150]

FGC57150
hg38 Position: ChrY:9992208..9992208
Ancestral: T
Derived: C
Reference: Full genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: Below FGC11 > Y5321 > Y20903
Forward Primer: FGC57150_F GTTATAAATTTCTGTGTGGTGCAATAC
Reverse Primer: FGC57150_R TGGGGATGGCAAGATACCA
Reviews

Customers who bought this product also purchased
FGC43122
FGC43122
FT362659
FT362659
ZS5010
ZS5010
FGC44917
FGC44917
FGC5
FGC5
FGC7393
FGC7393
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies