Top » Catalog » SNPs » FGC12359

$18.00

FGC12359
[FGC12359]

FGC12359
hg38 Position: ChrY:9213356..9213356
Ancestral: G
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC12359_F CAGGATCAGAACCTAGCCACTT
Reverse Primer: FGC12359_R AGCATACACAGCTAAGAGATTTAATCG
Reviews

Customers who bought this product also purchased
FGC12360
FGC12360
S18249
S18249
A8615
A8615
S16265
S16265
S10185
S10185
FGC12355
FGC12355
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies