Top » Catalog » SNPs » FGC12359

$18.00

FGC12359
[FGC12359]

FGC12359
hg38 Position: ChrY:9213356..9213356
Ancestral: G
Derived: C
Reference: Full Genomes (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: .
Forward Primer: FGC12359_F CAGGATCAGAACCTAGCCACTT
Reverse Primer: FGC12359_R AGCATACACAGCTAAGAGATTTAATCG
Reviews

Customers who bought this product also purchased
A8613
A8613
A8618
A8618
FGC12365
FGC12365
R1b Inman Segregation Panel
R1b Inman Segregation Panel
S10582
S10582
FGC12360
FGC12360
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies