Top » Catalog » SNPs » S7047

$18.00

S7047
[S7047]

S7047
hg38 Position: ChrY:14709736..14709736
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a1b
Comments: Downstream U106 > Z18 > Z2396
Forward Primer: S7047_F GAGGCCAAGGTGGGTGTATC
Reverse Primer: S7047_R AAATCATTTGGAATTTATTTATCTGG
Reviews

Customers who bought this product also purchased
S8402
S8402
L257
L257
BY114278
BY114278
Z372
Z372
FGC5797
FGC5797
Z18
Z18
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies