Top » Catalog » SNPs » S7047

$18.00

S7047
[S7047]

S7047
hg38 Position: ChrY:14709736..14709736
Ancestral: A
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a1b
Comments: Downstream U106 > Z18 > Z2396
Forward Primer: S7047_F GAGGCCAAGGTGGGTGTATC
Reverse Primer: S7047_R AAATCATTTGGAATTTATTTATCTGG
Reviews

Customers who bought this product also purchased
Z381
Z381
DF95
DF95
A6924
A6924
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
ZP87
ZP87
S8402
S8402
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies