Top » Catalog » SNPs » FGC1703

$18.00

FGC1703
[FGC1703]

FGC1703
hg38 Position: ChrY:7744420..7744420
Ancestral: C
Derived: G
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1 (not listed)
Comments: Aka Y10959
Forward Primer: FGC1703_F TGCCATTATTCTGAGCTCCC
Reverse Primer: FGC1703_R CAGAGTATTCTCCTGATTCCAGTG
Reviews

Customers who bought this product also purchased
DNA Sample Kit
DNA Sample Kit
FGC1696
FGC1696
P58
P58
FGC38706
FGC38706
FGC1729
FGC1729
ZS4717
ZS4717
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies