Top » Catalog » SNPs » FT263755

$18.00

FT263755
[FT263755]

FT263755
hg38 Position: ChrY:8461450..8461450
Ancestral: C
Derived: T
Reference: FTDNA (2020)
ISOGG Haplogroup: I1
Comments: Below M253 > S2304 > A9687 > BY61723
Forward Primer: FT263755_F CACAAAAAATTATAACTAACACATGTATTTTG
Reverse Primer: FT263755_R GACAGGGCCAAGCAGGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies