Top » Catalog » SNPs » FT44209

$18.00

FT44209
[FT44209]

FT44209
hg38 Position: ChrY:21039293..21039293
Ancestral: G
Derived: A
Reference: FTDNA (2019)
ISOGG Haplogroup: G
Comments: Below M406 > L14 > Y92117
Forward Primer: FT44209_F AGTGTTTGGGGCAAAGCAG
Reverse Primer: FT44209_R CTCAGTGATTTGCCCCTGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies