Top » Catalog » SNPs » Y92117

$18.00

Y92117
[Y92117]

Y92117
hg38 Position: ChrY:12650177..12650177
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: G
Comments: Below M406 > L14 > FGC5185
Forward Primer: Y92117_F AGTGAAGCTGAATATCTACTGTGCC
Reverse Primer: Y92117_R CTCTGCCTCCTGGGTTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies