Top » Catalog » SNPs » FT68850

$18.00

FT68850
[FT68850]

FT68850
hg38 Position: ChrY:19457392..19457392
Ancestral: T
Derived: C
Reference: FTDNA (2019)
ISOGG Haplogroup: E1b
Comments: M191 > Z1704 > Y172941
Forward Primer: FT68850_F ATTTCTCACCATGCCCACTC
Reverse Primer: FT68850_R TATACCTAGCCATGAGATTGCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies