Top » Catalog » SNPs » A27251

$18.00

A27251
[A27251]

A27251
hg38 Position: ChrY:3031341..3031341
Ancestral: G
Derived: A
Reference: YSEQ (2020)
ISOGG Haplogroup: R1b
Comments: Below DF21 > S971 > Z16267 > Z3004 > FGC41930 > A24191
Forward Primer: A27251_F CTGTTAGTCTGAGGGGCTTTG
Reverse Primer: A27251_R TGAAACCCATGGCACAAGAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies