Top » Catalog » SNPs » FT364122

$18.00

FT364122
[FT364122]

FT364122
hg38 Position: ChrY:19137499..19137499
Ancestral: T
Derived: C
Reference: FTDNA (2020)
ISOGG Haplogroup: E1b
Comments: .
Forward Primer: FT364122_F GGGAATAATCCCTTTGTTCTTTGTAG
Reverse Primer: FT364122_R TTTTTCTGTGACATTCTTCTGGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies