Top » Catalog » SNPs » VK31

$18.00

VK31
[VK31]

VK31
hg38 Position: ChrY:19300747..19300747
Ancestral: T
Derived: C
Reference: Viacheslav Kudryashov (2020)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: VK31_F GGAGTCTTGCTCTGTCACCTG
Reverse Primer: VK31_R CAGATACATCCAGATCACTTACATCTC
Reviews

Customers who bought this product also purchased
VK28
VK28
VK34
VK34
VK27
VK27
VK33
VK33
VK26
VK26
VK32
VK32
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies