Top » Catalog » SNPs » VK32

$18.00

VK32
[VK32]

VK32
hg38 Position: ChrY:20530288..20530288
Ancestral: A
Derived: G
Reference: Viacheslav Kudryashov (2020)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: VK32_F CGGCAAAGGGAAGCCTG
Reverse Primer: VK32_R TGGGTGCATATATATTTAGGATAGTTACC
Reviews

Customers who bought this product also purchased
VK31
VK31
VK25
VK25
VK30
VK30
VK29
VK29
VK28
VK28
VK34
VK34
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies