Top » Catalog » SNPs » A7367

$17.50

A7367
[A7367]

A7367
HG19 Position: ChrY:17939002..17939002
Ancestral: T
Derived: C
Reference: Colin Ferguson (2015)
ISOGG Haplogroup: R1b
Comments: Below S764 > Y16252
Forward Primer: A7367_F AATGGGGAGGACGGTAATTG
Reverse Primer: A7367_R GATGAAAAACATGTGACAACAGC
Reviews

Customers who bought this product also purchased
Y16252
Y16252
DF13
DF13
DF41
DF41
Z17613
Z17613
R1b-L21 Super-Clade Orientation Panel
R1b-L21 Super-Clade Orientation Panel
Z251
Z251
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies