Top » Catalog » SNPs » A7367

$18.00

A7367
[A7367]

A7367
HG19 Position: ChrY:17939002..17939002
Ancestral: T
Derived: C
Reference: Colin Ferguson (2015)
ISOGG Haplogroup: R1b
Comments: Below S764 > Y16252
Forward Primer: A7367_F AATGGGGAGGACGGTAATTG
Reverse Primer: A7367_R GATGAAAAACATGTGACAACAGC
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies