Top » Catalog » SNPs » A7367

$18.00

A7367
[A7367]

A7367
HG19 Position: ChrY:17939002..17939002
Ancestral: T
Derived: C
Reference: Colin Ferguson (2015)
ISOGG Haplogroup: R1b
Comments: Below S764 > Y16252
Forward Primer: A7367_F AATGGGGAGGACGGTAATTG
Reverse Primer: A7367_R GATGAAAAACATGTGACAACAGC
Reviews

Customers who bought this product also purchased
S691
S691
L1335
L1335
S764
S764
S9767
S9767
Z39589
Z39589
S744
S744
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies