Top » Catalog » SNPs » BY453

$18.00

BY453
[BY453]

BY453
hg38 Position: ChrY:8549988..8549988
Ancestral: A
Derived: G
Reference: FTDNA (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: BY453v2_F CATCTTTGGACTTTATCCTAGGATG
Reverse Primer: BY453v2_R AATCATTGAGCCAGACATAGGG
Reviews

Customers who bought this product also purchased
Y5497
Y5497
CTS6364
CTS6364
A5989
A5989
A13241
A13241
Y3647
Y3647
A13959
A13959
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies