Top » Catalog » SNPs » BY453

$18.00

BY453
[BY453]

BY453
hg38 Position: ChrY:8549988..8549988
Ancestral: A
Derived: G
Reference: FTDNA (2015)
ISOGG Haplogroup: I1 (not listed)
Comments: .
Forward Primer: BY453v2_F CATCTTTGGACTTTATCCTAGGATG
Reverse Primer: BY453v2_R AATCATTGAGCCAGACATAGGG
Reviews

Customers who bought this product also purchased
CTS2291
CTS2291
A13951
A13951
FT100000
FT100000
BY184902
BY184902
A13959
A13959
A6452
A6452
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies