Top » Catalog » SNPs » Y12990

$18.00

Y12990
[Y12990]

Y12990
hg38 Position: ChrY:19614499..19614499
Ancestral: G
Derived: A
Reference: YFull (2015)
ISOGG Haplogroup: I1
Comments: Aka A4600
Forward Primer: Y12990_F ATCTTGGCTTCTGTGGATGG
Reverse Primer: Y12990_R ATTTCTGCCAAGGTGTGTCC
Reviews

Customers who bought this product also purchased
I1-Z140 Panel
I1-Z140 Panel
A375
A375
FGC74328
FGC74328
A376
A376
FGC74330
FGC74330
YSC0000261
YSC0000261
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies