Top » Catalog » SNPs » YFS301984

$18.00

YFS301984
[YFS301984]

YFS301984
hg38 Position: ChrY:2814346..2814346
Ancestral: G
Derived: A
Reference: Yfull (2015)
ISOGG Haplogroup: I1a2a1a1a1
Comments: Downstream A376
Forward Primer: YFS301984_F TTAGCCAGGTGTGGTGTGTG
Reverse Primer: YFS301984_R AAGAACTCCAGGGCCTACTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies