Top » Catalog » SNPs » FGC30690

$18.00

FGC30690
[FGC30690]

FGC30690
hg38 Position: ChrY:10059971..10059971
Ancestral: A
Derived: G
Reference: Full Genomes Corp (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: Below S588
Forward Primer: FGC30690_F TCTGTTTCAATGACCCCAGG
Reverse Primer: FGC30690_R TGGGTCCTCAGGACCTTTTG
Reviews

Customers who bought this product also purchased
Y81784
Y81784
FGC10138
FGC10138
A17594
A17594
FGC19831
FGC19831
FGC23592
FGC23592
FGC16741
FGC16741
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies