Top » Catalog » SNPs » Z16435

$18.00

Z16435
[Z16435]

Z16435
hg38 Position: ChrY:8586654..8586654
Ancestral: ins
Derived: del
Reference: Alex Williamson (2014)
ISOGG Haplogroup: R1b1a2a1a2c1e (not listed)
Comments: downstream of Z255
Forward Primer: Z16435_F GGTGTCTTTTGATGTCTTTCTGTG
Reverse Primer: Z16435_R ATGGAGGAGAGCTCCTCAAGAC
Reviews

Customers who bought this product also purchased
BY198223
BY198223
BY56625
BY56625
PH158
PH158
BY109851
BY109851
R1b-Z255 Panel
R1b-Z255 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies