Top » Catalog » SNPs » Z2072

$18.00

Z2072
[Z2072]

Z2072
hg38 Position: ChrY:8933359..8933359
Ancestral: G
Derived: C
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: I2a2a1a2 (not listed)
Comments: downstream of M223; Z186; parallel to L801, syn with Z2057
Forward Primer: Z2072_F CATTACTGCAAGTATCACACGTACAG
Reverse Primer: Z2072_R TTCAAGCCTGAAGCTCTCAAC
Reviews

Customers who bought this product also purchased
Y10657
Y10657
Y31615
Y31615
P126
P126
Y4752
Y4752
Y21729
Y21729
M168
M168
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies