Top » Catalog » SNPs » A5846

$18.00

A5846
[A5846]

A5846
hg38 Position: ChrY:14927647..14927647
Ancestral: G
Derived: A
Reference: Alex Williamson (2015)
ISOGG Haplogroup: R1b1a2a1a2c (not listed)
Comments: Downstream L21* (DF13-. DF63-)
Forward Primer: A5846_F AGGCTGGTCTTGAATGCCTAG
Reverse Primer: A5846_R GTGCTGTTGCAAGCTGTTAAG
Reviews

Customers who bought this product also purchased
BY592
BY592
A91
A91
R1b-DF63 Panel
R1b-DF63 Panel
BY20329
BY20329
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
A7811
A7811
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies