Top » Catalog » SNPs » A5846

$18.00

A5846
[A5846]

A5846
hg38 Position: ChrY:14927647..14927647
Ancestral: G
Derived: A
Reference: Alex Williamson (2015)
ISOGG Haplogroup: R1b1a2a1a2c (not listed)
Comments: Downstream L21* (DF13-. DF63-)
Forward Primer: A5846_F AGGCTGGTCTTGAATGCCTAG
Reverse Primer: A5846_R GTGCTGTTGCAAGCTGTTAAG
Reviews

Customers who bought this product also purchased
A7907
A7907
FGC33712
FGC33712
CTS1751
CTS1751
BY3927
BY3927
DF27
DF27
FGC13780
FGC13780
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies