Top » Catalog » SNPs » Z2543

$18.00

Z2543
[Z2543]

Z2543
hg38 Position: ChrY:3292068..3292068
Ancestral: C
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of Z225/Z229. parallel to previously known branches
Forward Primer: Z2543_F CCATCATTTCAGCTCTGTTCC
Reverse Primer: Z2543_R ACCTGTTTTCTGCAGGGATG
Reviews

Customers who bought this product also purchased
FASTQ Mapping to hg38
FASTQ Mapping to hg38
P312
P312
Z225
Z225
BY15279
BY15279
L51
L51
Z2571
Z2571
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies