Top » Catalog » SNPs » Z2543

$18.00

Z2543
[Z2543]

Z2543
hg38 Position: ChrY:3292068..3292068
Ancestral: C
Derived: A
Reference: Ray Banks (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of Z225/Z229. parallel to previously known branches
Forward Primer: Z2543_F CCATCATTTCAGCTCTGTTCC
Reverse Primer: Z2543_R ACCTGTTTTCTGCAGGGATG
Reviews

Customers who bought this product also purchased
FASTQ Mapping to hg38
FASTQ Mapping to hg38
R1b-DF27 Panel
R1b-DF27 Panel
FGC13109
FGC13109
Z222
Z222
DF27
DF27
FGC20761
FGC20761
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies