Top » Catalog » SNPs » Z2560

$18.00

Z2560
[Z2560]

Z2560
hg38 Position: ChrY:19230589..19230589
Ancestral: C
Derived: T
Reference: Ray Banks (2015)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of DF27
Forward Primer: Z2560_F CCTGAGGAGTCACCACACTG
Reverse Primer: Z2560_R GCCCCTGCAAAAACAAGAG
Reviews

Customers who bought this product also purchased
A11625
A11625
BY129286
BY129286
A11632
A11632
BY16029
BY16029
FT65663
FT65663
BY21429
BY21429
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies