Top » Catalog » SNPs » BY1551

$18.00

BY1551
[BY1551]

BY1551
hg38 Position: ChrY:17411886..17411886
Ancestral: C
Derived: T
Reference: Big Y (2015)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY1551_F TTCCCCAATTACTCCTGCAC
Reverse Primer: BY1551_R TCTCAGTTCCATGTGGCATC
Reviews

Customers who bought this product also purchased
BY1734
BY1734
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies