Top » Catalog » SNPs » CTS4549

$18.00

CTS4549
[CTS4549]

CTS4549
hg38 Position: ChrY:13598216..13598216
Ancestral: G
Derived: A
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b (not listed)
Comments: Extracted from 1000 genomes data. Downstream Z690
Forward Primer: CTS4549_F TTTAGGTGCCAACAGCCAAC
Reverse Primer: CTS4549_R TCCCCAGCTTGTAGATGGTC
Reviews

Customers who bought this product also purchased
DF27
DF27
Z205
Z205
P312
P312
Z2571
Z2571
CTS8289
CTS8289
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies