Top » Catalog » SNPs » Y24054

$18.00

Y24054
[Y24054]

Y24054
hg38 Position: ChrY:7237656..7237656
Ancestral: T
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: I1
Comments: Below L22
Forward Primer: Y24054_F AAAATTCTCATTTCAAGCCTTTTATG
Reverse Primer: Y24054_R ATTCAGACCACAGCACCCAC
Reviews

Customers who bought this product also purchased
PH497
PH497
CTS6868
CTS6868
FGC28767
FGC28767
P109
P109
Z2338
Z2338
I1-L22 (including P109) Panel
I1-L22 (including P109) Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies