Top » Catalog » SNPs » Y24054

$18.00

Y24054
[Y24054]

Y24054
hg38 Position: ChrY:7237656..7237656
Ancestral: T
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: I1
Comments: Below L22
Forward Primer: Y24054_F AAAATTCTCATTTCAAGCCTTTTATG
Reverse Primer: Y24054_R ATTCAGACCACAGCACCCAC
Reviews

Customers who bought this product also purchased
L22
L22
PH497
PH497
CTS6868
CTS6868
FGC28767
FGC28767
P109
P109
Z2338
Z2338
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies