Top » Catalog » SNPs » Y179930

$18.00

Y179930
[Y179930]

Y179930
hg38 Position: ChrY:14956447..14956447
Ancestral: G
Derived: A
Reference: YFull (2019)
ISOGG Haplogroup: E1b
Comments: Below Z834 > M34 > Y4971
Forward Primer: Y179930_F ATAAGAGGGATATCACCACCAATG
Reverse Primer: Y179930_R ATTCAGTATGATATGGGTTGTGGT
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y220418
1 x BY174021
1 x FT20095
1 x Y220386
1 x BY202806
1 x ZS2449
1 x Y179930
1 x BY126948
$144.00
Haplogroup Info
Other products
Currencies