Top » Catalog » SNPs » Y179930

$18.00

Y179930
[Y179930]

Y179930
hg38 Position: ChrY:14956447..14956447
Ancestral: G
Derived: A
Reference: YFull (2019)
ISOGG Haplogroup: E1b
Comments: Below Z834 > M34 > Y4971
Forward Primer: Y179930_F ATAAGAGGGATATCACCACCAATG
Reverse Primer: Y179930_R ATTCAGTATGATATGGGTTGTGGT
Reviews

Customers who bought this product also purchased
Y6938
Y6938
A10728
A10728
Y22842
Y22842
L791
L791
Y6940
Y6940
Y15936
Y15936
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies