Top » Catalog » SNPs » CTS11567

$18.00

CTS11567
[CTS11567]

CTS11567
hg38 Position: ChrY:21001099..21001099
Ancestral: C
Derived: G
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a1a2a1a2a7~
Comments: Downstream Z2571
Forward Primer: CTS11567_F GGCATCACCAAGAAAAGGAG
Reverse Primer: CTS11567_R AACAGGAGGGATGGTGTGTC
Reviews

Customers who bought this product also purchased
Z196
Z196
DF84
DF84
R1b-DF27 Panel
R1b-DF27 Panel
A16656
A16656
L21
L21
BY31431
BY31431
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies