Top » Catalog » SNPs » CTS8289

$18.00

CTS8289
[CTS8289]

CTS8289
hg38 Position: ChrY:15808082..15808082
Ancestral: T
Derived: C
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a1a2a1a2a1b1a1a~
Comments: Syn. with CTS8289; downstream CTS4716
Forward Primer: CTS8289_F GAAAAAGATGCAAAAGGCTAAAG
Reverse Primer: CTS8289_R GGTTTTCTTTGCCCCAAAAG
Reviews

Customers who bought this product also purchased
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
S228
S228
CTS606
CTS606
Z296
Z296
CTS4549
CTS4549
R1b-DF27 Panel
R1b-DF27 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies